ncRNA ID | ath-miR5643b |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:11757140-11757222 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 3 - AGGCUUUUAAGAUCUGGUUGC - 23 |
Stem-loop(if miRNA) |
G        AA   CG  U      UU  CU         CU  UGUAGCCG  GUC  UA GAGUCU  GU  UUGUAUCCU  A  ||||||||  |||  || ||||||  ||  |||||||||  GCGUUGGU  UAG  AU UUCGGA  CA  AAUAUAGGA  A A        -C   -A  U      UU  -U         AC |
Stem-loop sequence | GUGUAGCCGAAGUCCGUAUGAGUCUUUGUCUUUGUAUCCUCUAACAAGGAUAUAAUACUUAGGCUUUUAAGAUCUGGUUGCGA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_179615.2 |
|
1.0 | Arabidopsis thaliana hypothetical protein partial mRNA | hypothetical protein(AT2G08986) | coding protein | psRNATarget | |||||||||
NM_103377.1 |
|
2.0 | Arabidopsis thaliana hypothetical protein partial mRNA | hypothetical protein(AT1G38790) | coding protein | psRNATarget | |||||||||
NM_179615.2 |
|
2.0 | Arabidopsis thaliana hypothetical protein partial mRNA | hypothetical protein(AT2G08986) | coding protein | psRNATarget |
1 | PMID:21940835
"High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis"; Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN; Genome Res. 22:163-176(2012). |