Search result

BaseInfo

ncRNA ID	gma-miR4415b-3p
Species	Glycine max
Class	miRNA
Genome position	chr8:23142767-23142922 [+]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	129 - UUGAUUCUCAUCACAACAUGG - 149
Stem-loop(if miRNA)	C    A                       -CAA    GCCAAGAAAAUGAAAUCCCAUUAUCUUCUCACAGU GGCUG AUCA GUUGUGAUGGGAAUCAAUGGCAG    UCAC                                   A ||||| |||| |||||||||||||||||||||||    ||||                                   U CUGAC UGGU CAACACUACUCUUAGUUACCGUC    CCUA                                   A      C    A                       AUUA    AAUAUAGGCAGUUGUGGUCAAUCGGAUUAAUUACU
Stem-loop sequence	GGCUGCAUCAAGUUGUGAUGGGAAUCAAUGGCAGCAAUCACGCCAAGAAAAUGAAAUCCCAUUAUCUUCUCACAGUAUAUCAUUAAUUAGGCUAACUGGUGUUGACGGAUAUAAAUCCAUUACUGCCAUUGAUUCUCAUCACAACAUGGUCCAGUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003543089.3	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *||*|||||||||=||||||| targets:267   ACACGUUGUGAUGGGAAUCAA   287 Target Full Sequence	2.5	PREDICTED: Glycine max L-ascorbate oxidase (LOC100808812), mRNA	L-ascorbate oxidase(LOC100808812)	coding protein	psRNATarget
XM_003555610.3	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *||*|||||||||=||||||| targets:278   ACACGUUGUGAUGGGAAUCAA   298 Target Full Sequence	2.5	PREDICTED: Glycine max L-ascorbate oxidase-like (LOC100776011), mRNA	L-ascorbate oxidase-like(LOC100776011)	coding protein	psRNATarget
XM_006601137.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:1878   GUAUGUUUUGAUGAGAAGCAA   1898 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100785728), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100785728)	coding protein	psRNATarget
XM_006601138.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:1911   GUAUGUUUUGAUGAGAAGCAA   1931 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100785728), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100785728)	coding protein	psRNATarget
XM_006601323.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:1944   GUAUGUUUUGAUGAGAAGCAA   1964 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100795787), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100795787)	coding protein	psRNATarget
XM_006586662.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:2084   GUAUGUUUUGAUGAGAAGCAA   2104 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100789457), transcript variant X4, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100789457)	coding protein	psRNATarget
XM_014761806.1	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:2019   GUAUGUUUUGAUGAGAAGCAA   2039 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100789457), transcript variant X3, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100789457)	coding protein	psRNATarget
XM_014761807.1	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:2084   GUAUGUUUUGAUGAGAAGCAA   2104 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100789457), transcript variant X5, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100789457)	coding protein	psRNATarget
XM_006586663.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:2085   GUAUGUUUUGAUGAGAAGCAA   2105 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100789457), transcript variant X6, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100789457)	coding protein	psRNATarget
XM_006586660.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:2085   GUAUGUUUUGAUGAGAAGCAA   2105 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100789457), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100789457)	coding protein	psRNATarget
XM_006586661.2	ncRNA:21   GGUACAACACUACUCUUAGUU   1   *=|||||*|||||||||*||| targets:2118   GUAUGUUUUGAUGAGAAGCAA   2138 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At2g13600-like (LOC100789457), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At2g13600-like(LOC100789457)	coding protein	psRNATarget

Reference

1	PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011).
2	PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011).