Search result

BaseInfo

ncRNA ID gma-miR166h-3p
Species Glycine max
Class miRNA
Genome position chr8:14990544-14990733 [+]
Reference genome v1.0
Source miRBase
Length 21
Mature sequence(if miRNA) 160 - UCUCGGACCAGGCUUCAUUCC - 180
Stem-loop(if miRNA) U    A           UU      CU      A  -----U C          UUUU     U             AAUUUA    U   UU    UC
 GGGG UGAUGGGAAUG  GUUUGG  CGAGGU AC      G AUGGUCUUAA    GUUCA CUUUUGAAGCUUU      UUUA GGG  UCAA  U
 |||| |||||||||||  ||||||  |||||| ||      | ||||||||||    ||||| |||||||||||||      |||| |||  ||||
 UUCC ACUGCCCUUAC  CGGACC  GCUCUA UG      C UAUCGGAGUU    UAGGU GGAAAUUUCGAAA      AAGU CCC  AGUU  U
-    A           UU      AG      G  UAUUUC C          ---U     U             AAGACA    U   -U    UU
Stem-loop sequence UGGGGAUGAUGGGAAUGUUGUUUGGCUCGAGGUAACUGCAUGGUCUUAAUUUUGUUCAUCUUUUGAAGCUUUAAUUUAUUUAUGGGUUUCAAUCUUUUUUGAUCCCUUGAAACAGAAAAAGCUUUAAAGGUUGGAUUUUGAGGCUAUCCCUUUAUGUGAUCUCGGACCAGGCUUCAUUCCCGUCAACCUU

Reference

1 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
2 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
3 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).