ncRNA ID | gma-miR5667-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr7:5340343-5340430 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - AAACAGAUCUAAAUGGAUUCC - 31 |
Stem-loop(if miRNA) |
G UG    A            C            ---C   A  A  U  GAAC GAGGAAUCCAUU AGAUCUGUUUCG    AAC CC U  |  |||| |||||||||||| ||||||||||||    ||| || A  A  CUUG UUCCUUAGGUAA UCUAGACAAAGU    UUG GG U - GU    A            A            CAGC   -  U |
Stem-loop sequence | GUUGGAACAGAGGAAUCCAUUCAGAUCUGUUUCGCAACACCAUAUUGGGUUCGACUGAAACAGAUCUAAAUGGAUUCCUUAGUUCUGA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
HI410511.1 |
|
1.5 | Sequence 8636 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
JB170972.1 |
|
1.5 | Sequence 8636 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
LQ242641.1 |
|
1.5 | Sequence 8636 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
XM_014779521.1 |
|
2.5 | PREDICTED: Glycine max chloroplast envelope membrane protein-like (LOC100799467), transcript variant X3, mRNA | chloroplast envelope membrane protein-like(LOC100799467) | coding protein | psRNATarget | |||||||||
XM_006586212.2 |
|
2.5 | PREDICTED: Glycine max chloroplast envelope membrane protein-like (LOC100799467), transcript variant X2, mRNA | chloroplast envelope membrane protein-like(LOC100799467) | coding protein | psRNATarget | |||||||||
XM_003532269.3 |
|
2.5 | PREDICTED: Glycine max chloroplast envelope membrane protein-like (LOC100799467), transcript variant X1, mRNA | chloroplast envelope membrane protein-like(LOC100799467) | coding protein | psRNATarget | |||||||||
XM_006577256.2 |
|
3.0 | PREDICTED: Glycine max exportin-4-like (LOC100804486), mRNA | exportin-4-like(LOC100804486) | coding protein | psRNATarget |
1 | PMID:21219599
"Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing"; Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS; BMC Plant Biol. 11:5(2011). |
2 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |
3 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |