ncRNA ID | gma-miR4379 |
Species | Glycine max |
Class | miRNA |
Genome position | chr7:1501189-1501272 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 60 - UAGAGUGUAUACUGUGAGAGGCCU - 83 |
Stem-loop(if miRNA) |
U           CU     A   CUAA    A   CAAA  C  UAGAGUGUAUA  GUGAG GGC    CUCA CCC    AG U  |||||||||||  ||||| |||    |||| |||    ||  AUCUUAUAUAU  UAUUC CCG    GAGU GGG    UC A A           -U     C   UUGG    A   -AAC  A |
Stem-loop sequence | UUAGAGUGUAUACUGUGAGAGGCCUAACUCAACCCCAAAAGCUAACUCAAGGGAUGAGGGUUGCCCCUUAUUUAUAUAUUCUAA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_006572896.2 |
|
1.5 | PREDICTED: Glycine max alpha/beta hydrolase domain-containing protein 17B-like (LOC100814433), transcript variant X4, mRNA | alpha/beta hydrolase domain-containing protein 17B-like(LOC100814433) | coding protein | psRNATarget | |||||||||
XM_006572894.2 |
|
1.5 | PREDICTED: Glycine max alpha/beta hydrolase domain-containing protein 17B-like (LOC100814433), transcript variant X2, mRNA | alpha/beta hydrolase domain-containing protein 17B-like(LOC100814433) | coding protein | psRNATarget | |||||||||
XM_006572893.2 |
|
1.5 | PREDICTED: Glycine max alpha/beta hydrolase domain-containing protein 17B-like (LOC100814433), transcript variant X1, mRNA | alpha/beta hydrolase domain-containing protein 17B-like(LOC100814433) | coding protein | psRNATarget | |||||||||
XM_006587545.2 |
|
2.5 | PREDICTED: Glycine max alpha/beta hydrolase domain-containing protein 17B-like (LOC100813362), mRNA | alpha/beta hydrolase domain-containing protein 17B-like(LOC100813362) | coding protein | psRNATarget |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |