Search result

BaseInfo

ncRNA ID	gma-miR394g
Species	Glycine max
Class	miRNA
Genome position	chr6:1502463-1502542 [-]
Reference genome	v1.0
Source	miRBase
Length	20
Mature sequence(if miRNA)	51 - UUGGCAUUCUGUCCACCUCC - 70
Stem-loop(if miRNA)	ACAGAG   C      U C           -ACUU U   CC       UUU UUGGCA U UGUCCACCUCC     C UGG  C       ||| |||||| | |||||||||||     | |||       AGA AACCGU A AUAGGUGGAGG     G AUC  U -----G   U      C U           CUCAU C   UA
Stem-loop sequence	ACAGAGUUUCUUGGCAUUCUGUCCACCUCCACUUCUUGGCCCUAUCUACGUACUCGGAGGUGGAUAUACUGCCAAUAGAG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006601824.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1172   GGAGGUUGACAGAAUGCCAA   1191 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100810179), transcript variant X2, mRNA	F-box only protein 6-like(LOC100810179)	coding protein	psRNATarget
XM_014764280.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1224   GGAGGUUGACAGAAUGCCAA   1243 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100795488), transcript variant X2, mRNA	F-box only protein 6-like(LOC100795488)	coding protein	psRNATarget
XM_006591384.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1239   GGAGGUUGACAGAAUGCCAA   1258 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100795488), transcript variant X1, mRNA	F-box only protein 6-like(LOC100795488)	coding protein	psRNATarget
XM_003551124.3	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1402   GGAGGUUGACAGAAUGCCAA   1421 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100810179), transcript variant X1, mRNA	F-box only protein 6-like(LOC100810179)	coding protein	psRNATarget
XM_014771056.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1516   GGAGGUUGACAGAAUGCCAA   1535 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100810179), transcript variant X3, mRNA	F-box only protein 6-like(LOC100810179)	coding protein	psRNATarget
XM_003531151.3	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1187   GGAGGUUGACAGAAUGCCAA   1206 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100775721), transcript variant X2, mRNA	F-box only protein 6-like(LOC100775721)	coding protein	psRNATarget
XM_014778856.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1087   GGAGGUUGACAGAAUGCCAA   1106 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100775721), transcript variant X3, mRNA	F-box only protein 6-like(LOC100775721)	coding protein	psRNATarget
NM_001289351.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1192   GGAGGUUGACAGAAUGCCAA   1211 Target Full Sequence	1.0	Glycine max F-box only protein 6-like (LOC100800464), mRNA	F-box only protein 6-like(LOC100800464)	coding protein	psRNATarget
BT093518.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1194   GGAGGUUGACAGAAUGCCAA   1213 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-24M21 unknown mRNA	NA	coding protein	psRNATarget
XM_014778855.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1187   GGAGGUUGACAGAAUGCCAA   1206 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100775721), transcript variant X1, mRNA	F-box only protein 6-like(LOC100775721)	coding protein	psRNATarget
XM_006604639.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   *|||||*||||*|||||||| targets:572   UGAGGUUGACAAAAUGCCAA   591 Target Full Sequence	2.5	PREDICTED: Glycine max monothiol glutaredoxin-S6-like (LOC100803979), mRNA	monothiol glutaredoxin-S6-like(LOC100803979)	coding protein	psRNATarget
XM_006603175.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1116   CUUGUUGGACAGAAUGCCAA   1135 Target Full Sequence	3.0	PREDICTED: Glycine max disease resistance RPP13-like protein 4 (LOC102666933), mRNA	disease resistance RPP13-like protein 4(LOC102666933)	coding protein	psRNATarget
XM_006586501.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1143   CUUGUUGGACAGAAUGCCAA   1162 Target Full Sequence	3.0	PREDICTED: Glycine max uncharacterized LOC102664151 (LOC102664151), mRNA	uncharacterized LOC102664151(LOC102664151)	coding protein	psRNATarget
XM_006585994.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1182   CUUGUUGGACAGAAUGCCAA   1201 Target Full Sequence	3.0	PREDICTED: Glycine max uncharacterized LOC102661060 (LOC102661060), mRNA	uncharacterized LOC102661060(LOC102661060)	coding protein	psRNATarget
XM_006585996.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1335   CUUGUUGGACAGAAUGCCAA   1354 Target Full Sequence	3.0	PREDICTED: Glycine max disease resistance RPP13-like protein 4 (LOC102662112), mRNA	disease resistance RPP13-like protein 4(LOC102662112)	coding protein	psRNATarget

Reference

1	PMID:22559273 "Genome organization and characteristics of soybean microRNAs"; Turner M, Yu O, Subramanian S; BMC Genomics. 13:169(2012).