Search result

BaseInfo

ncRNA ID	gma-miR2108b
Species	Glycine max
Class	miRNA
Genome position	chr5:11856516-11856582 [-]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	44 - UUAAUGUGUUGUGUUUGUGAG - 64
Stem-loop(if miRNA)	--UG          - UG    CCCCU GUUUUAA    UGUUGUGUUU G  AGAA     G |||||||    |||||||||| |  |||| CGGGAUU    GCGACGCGAA U  UUUU     A        UUGA          U GU    ACAUU
Stem-loop sequence	GUUUUAAUGUGUUGUGUUUGUGAGAACCCCUGAUUACAUUUUUGUUAAGCGCAGCGAGUUUUAGGGC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003544283.3	ncRNA:21   GAGUGUUUGUGUUGUGUAAUU   1   *||||*|||||||||||*||| targets:181   GUCACCAACACAACACAAUAA   201 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC100796249), mRNA	pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like(LOC100796249)	coding protein	psRNATarget
XM_003556720.3	ncRNA:21   GAGUGUUUGUGUUGUGUAAUU   1   **|||||||||||||||*||* targets:141   AACACAAACACAACACAAUAC   161 Target Full Sequence	2.5	PREDICTED: Glycine max ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic-like (LOC100801721), mRNA	ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic-like(LOC100801721)	coding protein	psRNATarget
XM_006597353.2	ncRNA:21   GAGUGU-UUGUGUUGUGUAAUU   1   **=|||-||||||||||||||| targets:60   AGUACACAACACAACACAUUAA   81 Target Full Sequence	3.0	PREDICTED: Glycine max TMV resistance protein N-like (LOC100806903), mRNA	TMV resistance protein N-like(LOC100806903)	coding protein	psRNATarget

Reference

1	PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"; Wang Y, Li P, Cao X, Wang X, Zhang A, Li X; Biochem Biophys Res Commun. 378:799-803(2009).