Search result

BaseInfo

ncRNA ID gma-miR1509b
Species Glycine max
Class miRNA
Genome position chr5:7774098-7774206 [-]
Reference genome v1.0
Source miRBase
Length 21
Mature sequence(if miRNA) 79 - UUAAUCAAGGAAAUCACGGUU - 99
Stem-loop(if miRNA) CU    C                U      U  GUGU         AAAG   CUUC
  GCAU UUUUUAAUCAAGGAAA CACGGU GA    GAAGGAGAG    UGG    A
  |||| |||||||||||||||| |||||| ||    |||||||||    |||
  UGUA AGAAAUUGGUUCCUUU GUGUCA CU    CUUCCUUUU    GCC    G
CG    U                -      C  ----         --GG   UUUA
Stem-loop sequence CUGCAUCUUUUUAAUCAAGGAAAUCACGGUUGAGUGUGAAGGAGAGAAAGUGGCUUCAGAUUUCCGGGUUUUCCUUCUCCACUGUGUUUCCUUGGUUAAAGAUAUGUGC

Reference

1 PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules";
Wang Y, Li P, Cao X, Wang X, Zhang A, Li X;
Biochem Biophys Res Commun. 378:799-803(2009).
2 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
3 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
4 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
5 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).