Search result

BaseInfo

ncRNA ID	gma-miR171b-3p
Species	Glycine max
Class	miRNA
Genome position	chr4:46988579-46988670 [+]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	62 - CGAGCCGAAUCAAUAUCACUC - 82
Stem-loop(if miRNA)	---      C  C           A      A        CAACCAU    UAGACA GG GUGAUAUUGGU CGGCUC UCUUAAUU       U    |||||| || ||||||||||| |||||| ||||||||    GUUUGU UC CACUAUAACUA GCCGAG AGAGUUAA       A UUC      -  U           A      C        CAACUAU
Stem-loop sequence	UAGACACGGCGUGAUAUUGGUACGGCUCAUCUUAAUUCAACCAUUAUAUCAACAAUUGAGACGAGCCGAAUCAAUAUCACUCUUGUUUGCUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003522536.3	ncRNA:21   CUCACUAUAACUAAGCCGAGC   1   |||||||||||=||||||||* targets:663   GAGUGAUAUUGGUUCGGCUCA   683 Target Full Sequence	2.5	PREDICTED: Glycine max nodulation-signaling pathway 2 protein (LOC100787926), mRNA	nodulation-signaling pathway 2 protein(LOC100787926)	coding protein	psRNATarget
XM_003527882.3	ncRNA:21   CUCACUAUAACUAAGCCGAGC   1   |||||||||||=||||||||* targets:608   GAGUGAUAUUGGUUCGGCUCA   628 Target Full Sequence	2.5	PREDICTED: Glycine max nodulation-signaling pathway 2 protein-like (LOC100782300), mRNA	nodulation-signaling pathway 2 protein-like(LOC100782300)	coding protein	psRNATarget

Reference

1	PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008).
2	PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010).
3	PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011).