Search result

BaseInfo

ncRNA ID ath-miR169b-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr5:8527469-8527649 [+]
Reference genome TAIR10
Source miRBase
Length 22
Mature sequence(if miRNA) 124 - GGCAAGUUGUCCUUCGGCUACA - 145
Stem-loop(if miRNA)      C    U  AA        AGU    U      U    C    -     UG           CGU    AAC   G       A    GU
CCCAA GGAG AG  UUGCAUGA   GGAG AGAGUA AAUG AGCC AAGGA  ACUUGCCGGAA   UGUU   CAU CAUAUGA UAAU  G
||||| |||| ||  ||||||||   |||| |||||| |||| |||| |||||  |||||||||||   ||||   ||| ||||||| ||||
GGGUU CCUU UC  AACGUACU   CUUC UCUCGU UUAC UCGG UUCCU  UGAACGGUCUU   ACAA   GUA GUGUAUU AUUA  A
     -    -  -A        CUU    -      U    A    C     GU           UAU    ---   -       A    GU
Stem-loop sequence CCCAACGGAGUAGAAUUGCAUGAAGUGGAGUAGAGUAUAAUGCAGCCAAGGAUGACUUGCCGGAACGUUGUUAACCAUGCAUAUGAAUAAUGUGAUGAUUAAUUAUGUGAUGAACAUAUUUCUGGCAAGUUGUCCUUCGGCUACAUUUUGCUCUCUUCUUCUCAUGCAAACUUUCCUUGGG

Reference

1 PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA";
Jones-Rhoades MW, Bartel DP;
Mol Cell. 14:787-799(2004).
2 PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets";
Wang XJ, Reyes JL, Chua NH, Gaasterland T;
Genome Biol. 5:R65(2004).
3 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
4 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
5 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
6 PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis";
Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW;
J Exp Bot. 61:165-177(2010).