ncRNA ID | ath-miR169b-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:8527469-8527649 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 124 - GGCAAGUUGUCCUUCGGCUACA - 145 |
Stem-loop(if miRNA) |
     C    U  AA        AGU    U      U    C    -     UG           CGU    AAC   G       A    GU CCCAA GGAG AG  UUGCAUGA   GGAG AGAGUA AAUG AGCC AAGGA  ACUUGCCGGAA   UGUU   CAU CAUAUGA UAAU  G ||||| |||| ||  ||||||||   |||| |||||| |||| |||| |||||  |||||||||||   ||||   ||| ||||||| |||| GGGUU CCUU UC  AACGUACU   CUUC UCUCGU UUAC UCGG UUCCU  UGAACGGUCUU   ACAA   GUA GUGUAUU AUUA  A      -    -  -A        CUU    -      U    A    C     GU           UAU    ---   -       A    GU |
Stem-loop sequence | CCCAACGGAGUAGAAUUGCAUGAAGUGGAGUAGAGUAUAAUGCAGCCAAGGAUGACUUGCCGGAACGUUGUUAACCAUGCAUAUGAAUAAUGUGAUGAUUAAUUAUGUGAUGAACAUAUUUCUGGCAAGUUGUCCUUCGGCUACAUUUUGCUCUCUUCUUCUCAUGCAAACUUUCCUUGGG |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |