ncRNA ID | gma-miR4412-5p |
Species | Glycine max |
Class | miRNA |
Genome position | chr4:28578980-28579067 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 65 - UGUUGCGGGUAUCUUUGCCUC - 85 |
Stem-loop(if miRNA) |
        C   U    U    U      G  --   UG  CCU AACUGUUG GGG AUCU UGCC CUGAAG AA  AGU  UG   A |||||||| ||| |||| |||| |||||| ||  |||  || UUGACAAC CCC UAGA GCGG GAUUUC UU  UCG  AU   U         A   C    U    U      G  AU   GU  UAU |
Stem-loop sequence | AACUGUUGCGGGUAUCUUUGCCUCUGAAGGAAAGUUGUGCCUAUUAUUAUGGCUUAUUGCUUUAGUGGCGUAGAUCCCCACAACAGUU |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
2 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
3 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
4 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |