Search result

BaseInfo

ncRNA ID gma-miR2109-5p
Species Glycine max
Class miRNA
Genome position chr4:28532454-28532524 [-]
Reference genome v1.0
Source miRBase
Length 20
Mature sequence(if miRNA) 50 - UGCGAGUGUCUUCGCCUCUG - 69
Stem-loop(if miRNA)     C        U          ---A     ACU
GGUG GAGUGUCU CGCCUCUGAG    GAGAU   A
|||| |||||||| ||||||||||    |||||
CCAC CUCAUAGA GCGGAGGCUC    CUCUA   U
    A        U          CGAA     GAG
Stem-loop sequence GGUGCGAGUGUCUUCGCCUCUGAGAGAGAUACUAUGAGAUCUCAAGCCUCGGAGGCGUAGAUACUCACACC

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_003548583.3
ncRNA:20   GUCUCCGCUUCUGUGAGCGU   1
  ||||||*||||||||*||||
targets:233   CAGAGGAGAAGACACGCGCA   252

2.5 PREDICTED: Glycine max TMV resistance protein N-like (LOC100809413), mRNA TMV resistance protein N-like(LOC100809413) coding protein psRNATarget

Reference

1 PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules";
Wang Y, Li P, Cao X, Wang X, Zhang A, Li X;
Biochem Biophys Res Commun. 378:799-803(2009).
2 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
3 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
4 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
5 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).