ncRNA ID | gma-miR9746f |
Species | Glycine max |
Class | miRNA |
Genome position | chr3:2873722-2873831 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 82 - AAAGUGUUUGAAUCUCAAUUAGAU - 105 |
Stem-loop(if miRNA) |
AC       C                       A   A U          GUUU   GGUUAUC AAUUGAGAUUCAAGCACUUUUCU UGU G UUUAAGGUGU    G   ||||||| ||||||||||||||||||||||| ||| | ||||||||||    A   CCAAUAG UUAACUCUAAGUUUGUGAAAAGA GUA C AAAUUCCACA    A -A       A                       A   C U          AGGU |
Stem-loop sequence | ACGGUUAUCCAAUUGAGAUUCAAGCACUUUUCUAUGUAGUUUUAAGGUGUGUUUGAAUGGAACACCUUAAAUCCAUGAAGAAAAGUGUUUGAAUCUCAAUUAGAUAACCA |
1 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |