ncRNA ID | gma-miR9746i |
Species | Glycine max |
Class | miRNA |
Genome position | chr3:2866172-2866310 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 96 - AAAGUGUUUGAAUUUCAAUUAGAU - 119 |
Stem-loop(if miRNA) |
        C      C       C                       A     C          GUUU AUAUCAAG UGUUUA GGUUAUC AAUUGAGAUUCAAGCACUUUUCU UGUGG UUUAAGGUGU    G |||||||| |||||| ||||||| ||||||||||||||||||||||| ||||| ||||||||||    A UAUAGUUC ACAGAU CCAAUAG UUAACUUUAAGUUUGUGAAAAGA GUACC AAAUUCCACA    A         A      A       A                       A     U          AGGU |
Stem-loop sequence | AUAUCAAGCUGUUUACGGUUAUCCAAUUGAGAUUCAAGCACUUUUCUAUGUGGCUUUAAGGUGUGUUUGAAUGGAACACCUUAAAUCCAUGAAGAAAAGUGUUUGAAUUUCAAUUAGAUAACCAUAGACAACUUGAUAU |
1 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |