Search result

BaseInfo

ncRNA ID gma-miR4414-5p
Species Glycine max
Class miRNA
Genome position chr20:35663002-35663129 [+]
Reference genome v1.0
Source miRBase
Length 20
Mature sequence(if miRNA) 11 - AGCUGCUGACUCGUUGGCUC - 30
Stem-loop(if miRNA) --      ACU     G   AC       C   AG   U       --------AA   AGAUUGAUG
  ACUGAA   CAGCU CUG  UCGUUGG UCG  AGU CACCAUU          GAU         U
  ||||||   ||||| |||  ||||||| |||  ||| |||||||          |||         U
  UGACUU   GUCGA GGC  AGCAACC AGU  UCG GUGGUGG          CCG         C
GC      -AC     G   GU       U   CU   U       AAUUAAUGUA   CACUCACGG
Stem-loop sequence ACUGAAACUCAGCUGCUGACUCGUUGGCUCGAGAGUUCACCAUUAAGAUAGAUUGAUGUUCGGCACUCACGCCAUGUAAUUAAGGUGGUGUGCUUCUGAUCCAACGAUGCGGGAGCUGCAUUCAGUCG

Reference

1 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
2 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).