ncRNA ID | gma-miR482b-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr20:35360325-35360393 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 48 - UCUUCCCUACACCUCCCAUACC - 69 |
Stem-loop(if miRNA) |
           -AUU           UC    AG GGUAUGGGGGG    GGGAAGGAAUA  CAUA  C |||||||||||    |||||||||||  ||||  A CCAUACCCUCC    CCCUUCUUUAU  GUAU  A            ACAU           -C    AA |
Stem-loop sequence | GGUAUGGGGGGAUUGGGAAGGAAUAUCCAUAAGCAAAAUAUGCUAUUUCUUCCCUACACCUCCCAUACC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003533558.3 |
|
2.5 | PREDICTED: Glycine max probable disease resistance protein At5g63020 (LOC100781638), mRNA | probable disease resistance protein At5g63020(LOC100781638) | coding protein | psRNATarget |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
2 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
3 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |