Search result

BaseInfo

ncRNA ID gma-miR482b-5p
Species Glycine max
Class miRNA
Genome position chr20:35360325-35360393 [+]
Reference genome v1.0
Source miRBase
Length 22
Mature sequence(if miRNA) 3 - UAUGGGGGGAUUGGGAAGGAAU - 24
Stem-loop(if miRNA)            -AUU           UC    AG
GGUAUGGGGGG    GGGAAGGAAUA  CAUA  C
|||||||||||    |||||||||||  ||||  A
CCAUACCCUCC    CCCUUCUUUAU  GUAU  A
           ACAU           -C    AA
Stem-loop sequence GGUAUGGGGGGAUUGGGAAGGAAUAUCCAUAAGCAAAAUAUGCUAUUUCUUCCCUACACCUCCCAUACC

Reference

1 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
2 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
3 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).