ncRNA ID | gma-miR2118a-5p |
Species | Glycine max |
Class | miRNA |
Genome position | chr20:35349726-35349895 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 34 - GGAGAUGGGAGGGUCGGUAAAG - 55 |
Stem-loop(if miRNA) |
-AAG          AA     U        G       A    A   -         -------------      --U      ---C    CU     GGAAAGGGAG  GAGCU GAGGAAGU AUGGGAG UGGG GGG UCGGUAAAG             AAUAUA   CUGAGA    UCGA  C     ||||||||||  ||||| |||||||| ||||||| |||| ||| |||||||||             ||||||   ||||||    ||||  A     CCUUUCUCUC  CUUGG UUCCUUUA UAUCCUU ACCC CCU AGCCGUUUU             UUGUGU   GACUCU    AGCU  A CUCA          --     C        G       -    A   U         CCUAUUUGUUUUG      UGU      CUCU    CU |
Stem-loop sequence | AAGGGAAAGGGAGAAGAGCUUGAGGAAGUGAUGGGAGAUGGGAGGGUCGGUAAAGAAUAUAUCUGAGACUCGACUCAAUCUCGAUCUCUCUCAGUGUUGUGUUGUUUUGUUUAUCCUUUUGCCGAUUCCACCCAUUCCUAUGAUUUCCUUCGGUUCCUCUCUUUCCACUC |
1 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
2 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
3 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |
4 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |