ncRNA ID | gma-miR9757 |
Species | Glycine max |
Class | miRNA |
Genome position | chr2:48299301-48299442 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 23 - CAACCCUCCUCAGUUAGAUCUC - 44 |
Stem-loop(if miRNA) |
              C                      A      G C   C         -UG  U   C CCAAUGCUACCAAA ACUGGCUCAACCCUCCUCAGUU GAUCUC U AAA AGCGAGGCG   AA UCG U |||||||||||||| |||||||||||||||||||||| |||||| | ||| |||||||||   || ||| C GGUUACGAUGGUUU UGACCGAGUUGGGAGGAGUUAA CUAGAG A UUU UCGUUCCGU   UU AGU C               U                      C      G A   A         UCA  C   U |
Stem-loop sequence | CCAAUGCUACCAAACACUGGCUCAACCCUCCUCAGUUAGAUCUCGUCAAACAGCGAGGCGUGAAUUCGCUCCUUGACUUACUUGCCUUGCUAUUUAAGGAGAUCCAAUUGAGGAGGGUUGAGCCAGUUUUUGGUAGCAUUGG |
1 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |