ncRNA ID | gma-miR393c-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr2:47136206-47136318 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 8 - AUCAUGCUAUCCCUUUGGAUU - 28 |
Stem-loop(if miRNA) |
G       C            C    U          -UUC   UUUAUAAAUUUUU  GAGGAGG AUCCAAAGGGAU GCAU GAUCCCAAAU    AGA             C  ||||||| |||||||||||| |||| ||||||||||    |||  UUCCUCC UAGGUUUCCCUA CGUA CUAGGGUUUA    UCU             U -       U            U    -          UAAC   UCCCCUCCCUUUC |
Stem-loop sequence | GGAGGAGGCAUCCAAAGGGAUCGCAUUGAUCCCAAAUUUCAGAUUUAUAAAUUUUUCUCUUUCCCUCCCCUUCUCAAUAUUUGGGAUCAUGCUAUCCCUUUGGAUUCCUCCUU |
1 | PMID:22559273
"Genome organization and characteristics of soybean microRNAs"; Turner M, Yu O, Subramanian S; BMC Genomics. 13:169(2012). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |