ncRNA ID | gma-miR169j-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr2:46876643-46876727 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 4 - UUUCGACGAGUUGUUCUUGGC - 24 |
Stem-loop(if miRNA) |
           UG     C      G      -UU    AGG GUAGCCAAGAA  ACUUG CGGAAU CAUGCA   UAUU   U |||||||||||  ||||| |||||| ||||||   ||||   A CAUCGGUUCUU  UGAGC GCUUUA GUAUGU   GUGG   C            GU     A      -      UAU    AAC |
Stem-loop sequence | GUAGCCAAGAAUGACUUGCCGGAAUGCAUGCAUUUAUUAGGUACCAAGGUGUAUUGUAUGAUUUCGACGAGUUGUUCUUGGCUAC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003517717.3 |
|
3.0 | PREDICTED: Glycine max potassium transporter 6-like (LOC100793141), mRNA | potassium transporter 6-like(LOC100793141) | coding protein | psRNATarget |
1 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
2 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |