ncRNA ID | gma-miR5771 |
Species | Glycine max |
Class | miRNA |
Genome position | chr2:41082462-41082542 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 48 - AUCUCAAGUGGAUUGCUUAAGGAC - 71 |
Stem-loop(if miRNA) |
C    G UGAU  AGA    G     G       -AA    AG  CCUG G    UC   AGUU UUAAG AAUUUAC   GGAU  U  |||| |    ||   |||| ||||| |||||||   ||||  G  GGAU C    AG   UCAG AAUUC UUAGGUG   UCUA  G -    G ----  --G    G     G       AAC    AA |
Stem-loop sequence | CCCUGGGUGAUUCAGAAGUUGUUAAGGAAUUUACAAGGAUAGUGGAAAUCUCAAGUGGAUUGCUUAAGGACUGGACGUAGG |
1 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |