ncRNA ID | gma-miR9751 |
Species | Glycine max |
Class | miRNA |
Genome position | chr2:14745286-14745382 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 69 - GUAAUUUUAAACCUAAACCCUAAA - 92 |
Stem-loop(if miRNA) |
-UCAAGG                     A    --UUCUCAUUCU  UU        UAAUUUUAAACCUAAACCCUA AUUA            GA  C        ||||||||||||||||||||| ||||            ||        AUUAAAAUUUGGAUUUGGGAU UAAU            CU  A UGACUUA                     C    CCCAAUACUCGU  UU |
Stem-loop sequence | UCAAGGUAAUUUUAAACCUAAACCCUAAAUUAUUCUCAUUCUGAUUCAUUUCUGCUCAUAACCCUAAUCUAGGGUUUAGGUUUAAAAUUAAUUCAGU |
1 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |