Search result

BaseInfo

ncRNA ID gma-miR482a-3p
Species Glycine max
Class miRNA
Genome position chr2:7783819-7783913 [+]
Reference genome v1.0
Source miRBase
Length 24
Mature sequence(if miRNA) 62 - UCUUCCCAAUUCCGCCCAUUCCUA - 85
Stem-loop(if miRNA)       U UG           -U          C   -GU    UGG
UCAGAA U  UGGGAAUGGGC  GAUUGGGAAG AAU   GUGC   U
|||||| |  |||||||||||  |||||||||| |||   ||||   G
AGUCUU A  AUCCUUACCCG  UUAACCCUUC UUA   UACG   C
      U GU           CC          U   AUU    UAA
Stem-loop sequence UCAGAAUUUGUGGGAAUGGGCUGAUUGGGAAGCAAUGUGUGCUGGUGCAAUGCAUUUAAUUUCUUCCCAAUUCCGCCCAUUCCUAUGAUUUCUGA

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_006588226.2
ncRNA:24   AUCC---UUACC-CGCCUUAACCCUUCU   1
  *|||---|||||-|*|||||||||||||
targets:27   GAGGGAAAAUGGAGAGGAAUUGGGAAGA   54

3.0 PREDICTED: Glycine max probable serine/threonine-protein kinase At1g18390 (LOC102665385), mRNA probable serine/threonine-protein kinase At1g18390(LOC102665385) coding protein psRNATarget

Reference

1 PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots";
Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O;
BMC Genomics. 9:160(2008).
2 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
3 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
4 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
5 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).