ncRNA ID | gma-miR4416a |
Species | Glycine max |
Class | miRNA |
Genome position | chr19:40699080-40699209 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 11 - ACGGGUCGCUCUCACCUAGG - 30 |
Stem-loop(if miRNA) |
----     AU           AA  G         ---G   UG  UUCAGUUCUGGUCUCACACGG     CUUUG  CUGGGUGAGAG  AC CGUAUCGAU    GAU  GG                     U     |||||  |||||||||||  || |||||||||    |||  ||                     U     GAGAC  GAUCCACUCUC  UG GCAUAGCUA    UGU  GU                     U CGUU     CG           GC  G         GUUU   --  CAGUCAUGUUUAACAAUCUUG |
Stem-loop sequence | CUUUGAUCUGGGUGAGAGAAACGCGUAUCGAUGGAUUGGGUUCAGUUCUGGUCUCACACGGUUUGUUCUAACAAUUUGUACUGACUGUGUUUUGAUCGAUACGGGUCGCUCUCACCUAGGCCAGAGUUGC |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |