Search result

BaseInfo

ncRNA ID gma-miR4416a
Species Glycine max
Class miRNA
Genome position chr19:40699080-40699209 [-]
Reference genome v1.0
Source miRBase
Length 20
Mature sequence(if miRNA) 11 - ACGGGUCGCUCUCACCUAGG - 30
Stem-loop(if miRNA) ----     AU           AA  G         ---G   UG  UUCAGUUCUGGUCUCACACGG
    CUUUG  CUGGGUGAGAG  AC CGUAUCGAU    GAU  GG                     U
    |||||  |||||||||||  || |||||||||    |||  ||                     U
    GAGAC  GAUCCACUCUC  UG GCAUAGCUA    UGU  GU                     U
CGUU     CG           GC  G         GUUU   --  CAGUCAUGUUUAACAAUCUUG
Stem-loop sequence CUUUGAUCUGGGUGAGAGAAACGCGUAUCGAUGGAUUGGGUUCAGUUCUGGUCUCACACGGUUUGUUCUAACAAUUUGUACUGACUGUGUUUUGAUCGAUACGGGUCGCUCUCACCUAGGCCAGAGUUGC

Reference

1 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
2 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).