ncRNA ID | ath-miR398b-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:4691022-4691137 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 12 - AGGGUUGAUAUGAGAACACAC - 32 |
Stem-loop(if miRNA) |
U   U    A     U    A          C   U   CAAC       ---        GGA CUCG CAGGG UGAU UGAGAACACA GAG AAU    GGCUGUA   AUGACGC  ||| |||| ||||| |||| |||||||||| ||| |||    |||||||   ||||||U  UCU GAGU GUCCC ACUG ACUCUUGUGU CUU UUG    UCGACAU   UACUGCA U   C    C     C    G          A   -   -CUC       UGU       |
Stem-loop sequence | UGGAUCUCGACAGGGUUGAUAUGAGAACACACGAGUAAUCAACGGCUGUAAUGACGCUACGUCAUUGUUACAGCUCUCGUUUUCAUGUGUUCUCAGGUCACCCCUGCUGAGCUCUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_121459.5 |
|
0.0 | Arabidopsis thaliana Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein mRNA | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein(AT5G14550) | coding protein | psRNATarget | |||||||||
NM_123150.1 |
|
2.5 | Arabidopsis thaliana Protein with RING/U-box and TRAF-like domain partial mRNA | Protein with RING/U-box and TRAF-like domain(AT5G37910) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |