ncRNA ID | gma-miR5786 |
Species | Glycine max |
Class | miRNA |
Genome position | chr19:1902504-1902643 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - UGUCGCAGGAUAGAGGGCACU - 31 |
Stem-loop(if miRNA) |
G                      A         G    --    - AUGAUGCAUGCAAAAAUAUAUUAUG  AGAGAGUCUUGUCGCAGGAUAG GGGCACUGG UAUG  GCAU G                         U  |||||||||||||||||||||| ||||||||| ||||  |||| |  UCUCUUAGAACAGCGUUCUGUC CCUGUGAUC AUAU  AUAU U                         G G                      -         G    AA    U AUGUACGAAUUAAUACUAAAGUCGU |
Stem-loop sequence | GAGAGAGUCUUGUCGCAGGAUAGAGGGCACUGGGUAUGGCAUGAUGAUGCAUGCAAAAAUAUAUUAUGUGUGCUGAAAUCAUAAUUAAGCAUGUAUUUAUAAAUAUAGCUAGUGUCCCUGUCUUGCGACAAGAUUCUCUG |
1 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |