Search result

BaseInfo

ncRNA ID	gma-miR4413a
Species	Glycine max
Class	miRNA
Genome position	chr19:1788524-1788610 [+]
Reference genome	v1.0
Source	miRBase
Length	20
Mature sequence(if miRNA)	9 - AAGAGAAUUGUAAGUCACUG - 28
Stem-loop(if miRNA)	UCAUC                            AUUA G A   U      AAUAAGAGAAUUGUAAGUCACUGUAUUA    G A CUG U      ||||||||||||||||||||||||||||    | | ||| G      UUAUUCUCUUAACAUUCAGUGACAUAGU    C U GAU A ---AA                            ---A G A   U
Stem-loop sequence	UCAUCAAUAAGAGAAUUGUAAGUCACUGUAUUAAUUAGGAACUGUUGAUUAGAUGCAUGAUACAGUGACUUACAAUUCUCUUAUUAA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003530008.3	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |||||||||||||||||||| targets:1273   CAGUGACUUACAAUUCUCUU   1292 Target Full Sequence	0.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100820602), mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100820602)	coding protein	psRNATarget
XM_014769021.1	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   =*|||||||||||||||||| targets:1313   UUGUGACUUACAAUUCUCUU   1332 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62910-like (LOC106796564), mRNA	pentatricopeptide repeat-containing protein At1g62910-like(LOC106796564)	coding protein	psRNATarget
XM_014768489.1	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |||||||*|||||||||||| targets:1160   CAGUGACGUACAAUUCUCUU   1179 Target Full Sequence	1.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like (LOC100795807), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like(LOC100795807)	coding protein	psRNATarget
XM_006587401.2	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |||||||*|||||||||||| targets:1160   CAGUGACAUACAAUUCUCUU   1179 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100781818), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100781818)	coding protein	psRNATarget
XM_014768490.1	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |||||||*|||||||||||| targets:1289   CAGUGACGUACAAUUCUCUU   1308 Target Full Sequence	1.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like (LOC100795807), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like(LOC100795807)	coding protein	psRNATarget
XM_014769273.1	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |||||||*|||||||||||| targets:1353   CAGUGACGUACAAUUCUCUU   1372 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106796589), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106796589)	coding protein	psRNATarget
XM_014762238.1	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |=||*||||||||||||||| targets:1242   CGGUCACUUACAAUUCUCUU   1261 Target Full Sequence	2.0	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794624), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794624)	coding protein	psRNATarget
XM_014765336.1	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   ==||*||||||||||||||| targets:323   UGGUCACUUACAAUUCUCUU   342 Target Full Sequence	2.0	PREDICTED: Glycine max putative disease resistance protein At4g11170 (LOC100793798), transcript variant X2, mRNA	putative disease resistance protein At4g11170(LOC100793798)	coding protein	psRNATarget
XM_006599565.2	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   =*||||||||=||||||||| targets:1489   UUGUGACUUAUAAUUCUCUU   1508 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62910-like (LOC100786237), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At1g62910-like(LOC100786237)	coding protein	psRNATarget
XM_006587773.2	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |*|||||*|||||||||||| targets:1298   CCGUGACGUACAAUUCUCUU   1317 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100778420), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100778420)	coding protein	psRNATarget
XM_006587774.2	ncRNA:20   GUCACUGAAUGUUAAGAGAA   1   |*|||||*|||||||||||| targets:1298   CCGUGACGUACAAUUCUCUU   1317 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100778420), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100778420)	coding protein	psRNATarget

Reference

1	PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010).
2	PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014).