ncRNA ID | gma-miR862a |
Species | Glycine max |
Class | miRNA |
Genome position | chr18:61624606-61624695 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 10 - UGCUGGAUGUCUUUGAAGGAAU - 31 |
Stem-loop(if miRNA) |
  UC    U     C        U           UU  UACCU AG  UUCG GUUCC UCAAAGGC UCCAGUAUUCA  CA     A ||  |||| ||||| |||||||| |||||||||||  || UC  AAGU UAAGG AGUUUCUG AGGUCGUAAGU  GU     A   GA    U     A        U           UC  UGAUC |
Stem-loop sequence | AGUCUUCGUGUUCCCUCAAAGGCUUCCAGUAUUCAUUCAUACCUAACUAGUUGCUUGAAUGCUGGAUGUCUUUGAAGGAAUUUGAAAGCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003545177.3 |
|
2.5 | PREDICTED: Glycine max uncharacterized protein At3g28850-like (LOC100816516), mRNA | uncharacterized protein At3g28850-like(LOC100816516) | coding protein | psRNATarget |
1 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
2 | PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011). |
3 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
4 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |