Search result

BaseInfo

ncRNA ID gma-miR862a
Species Glycine max
Class miRNA
Genome position chr18:61624606-61624695 [-]
Reference genome v1.0
Source miRBase
Length 22
Mature sequence(if miRNA) 10 - UGCUGGAUGUCUUUGAAGGAAU - 31
Stem-loop(if miRNA)   UC    U     C        U           UU  UACCU
AG  UUCG GUUCC UCAAAGGC UCCAGUAUUCA  CA     A
||  |||| ||||| |||||||| |||||||||||  ||
UC  AAGU UAAGG AGUUUCUG AGGUCGUAAGU  GU     A
  GA    U     A        U           UC  UGAUC
Stem-loop sequence AGUCUUCGUGUUCCCUCAAAGGCUUCCAGUAUUCAUUCAUACCUAACUAGUUGCUUGAAUGCUGGAUGUCUUUGAAGGAAUUUGAAAGCU

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_003545177.3
ncRNA:22   UAAGGAAGUUUCUGUAGGUCGU   1
  **||||||||||||||||||*=
targets:293   CCUCCUUCAAAGACAUCCAGAG   314

2.5 PREDICTED: Glycine max uncharacterized protein At3g28850-like (LOC100816516), mRNA uncharacterized protein At3g28850-like(LOC100816516) coding protein psRNATarget

Reference

1 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
2 PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome";
Radwan O, Liu Y, Clough SJ;
Mol Plant Microbe Interact. 24:958-972(2011).
3 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
4 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).