ncRNA ID | gma-miR482c-5p |
Species | Glycine max |
Class | miRNA |
Genome position | chr18:61452908-61452997 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 23 |
Mature sequence(if miRNA) | 65 - AUUUGUGGGAAUGGGCUGAUUGG - 87 |
Stem-loop(if miRNA) |
-    U UG           -U         GUAAU         CA  AGAA U  UGGGAAUGGGC  GAUUGGGAA     GAGAUUGAG  A  |||| |  |||||||||||  |||||||||     |||||||||  U  UCUU A  AUCCUUACCCG  UUAACCCUU     CUUUAAUUU  A G    U GU           CC         -----         AC |
Stem-loop sequence | AGAAUUUGUGGGAAUGGGCUGAUUGGGAAGUAAUGAGAUUGAGCAAUACAUUUAAUUUCUUCCCAAUUCCGCCCAUUCCUAUGAUUUCUG |
1 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
2 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
3 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |