Search result

BaseInfo

ncRNA ID gma-miR482c-5p
Species Glycine max
Class miRNA
Genome position chr18:61452908-61452997 [-]
Reference genome v1.0
Source miRBase
Length 23
Mature sequence(if miRNA) 65 - AUUUGUGGGAAUGGGCUGAUUGG - 87
Stem-loop(if miRNA) -    U UG           -U         GUAAU         CA
 AGAA U  UGGGAAUGGGC  GAUUGGGAA     GAGAUUGAG  A
 |||| |  |||||||||||  |||||||||     |||||||||  U
 UCUU A  AUCCUUACCCG  UUAACCCUU     CUUUAAUUU  A
G    U GU           CC         -----         AC
Stem-loop sequence AGAAUUUGUGGGAAUGGGCUGAUUGGGAAGUAAUGAGAUUGAGCAAUACAUUUAAUUUCUUCCCAAUUCCGCCCAUUCCUAUGAUUUCUG

Reference

1 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
2 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
3 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).