ncRNA ID | gma-miR1512a-5p |
Species | Glycine max |
Class | miRNA |
Genome position | chr18:60819566-60819660 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 11 - UAACUGAAAAUUCUUAAAGUAU - 32 |
Stem-loop(if miRNA) |
-UC     U C         A                 -  A   AAA    UUGAU C UAACUGAAA UUCUUAAAGUAUUCCCA UC UCG   U    ||||| | ||||||||| ||||||||||||||||| || |||    AACUA G AUUGACUUU AAGAAUUUCGUAAGGGU AG AGU   G ACU     C U         -                 U  A   AAA |
Stem-loop sequence | UCUUGAUUCCUAACUGAAAAUUCUUAAAGUAUUCCCAUCAUCGAAAUGAAAUGAAGAUUGGGAAUGCUUUAAGAAUUUCAGUUAUGCAUCAAUCA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_014778416.1 |
|
1.5 | PREDICTED: Glycine max putative cysteine-rich receptor-like protein kinase 32 (LOC100802852), mRNA | putative cysteine-rich receptor-like protein kinase 32(LOC100802852) | coding protein | psRNATarget | |||||||||
XM_003540516.3 |
|
2.5 | PREDICTED: Glycine max probable beta-1,3-galactosyltransferase 8 (LOC100803654), mRNA | probable beta-1,3-galactosyltransferase 8(LOC100803654) | coding protein | psRNATarget | |||||||||
XM_003533478.3 |
|
2.5 | PREDICTED: Glycine max probable beta-1,3-galactosyltransferase 8 (LOC100776291), transcript variant X2, mRNA | probable beta-1,3-galactosyltransferase 8(LOC100776291) | coding protein | psRNATarget | |||||||||
XM_006587660.2 |
|
2.5 | PREDICTED: Glycine max probable beta-1,3-galactosyltransferase 8 (LOC100776291), transcript variant X1, mRNA | probable beta-1,3-galactosyltransferase 8(LOC100776291) | coding protein | psRNATarget |
1 | PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |