ncRNA ID | gma-miR4387d |
Species | Glycine max |
Class | miRNA |
Genome position | chr18:48035663-48035768 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 10 - AUGUCACUGAUUAGGCAUGAUGAU - 33 |
Stem-loop(if miRNA) |
                     U    U      C   U        C  CAC GAGUGUCACGUUAUCAUGUCU GUCA UGACAU UCA UGUCAUGU AU   C ||||||||||||||||||||| |||| |||||| ||| |||||||| || CUCACAGUGUAGUAGUACGGA UAGU ACUGUA AGU ACAGUGCA UA   U                      U    C      U   U        A  ACU |
Stem-loop sequence | GAGUGUCACGUUAUCAUGUCUUGUCAUUGACAUCUCAUUGUCAUGUCAUCACCUUCAAUAACGUGACAUUGAUAUGUCACUGAUUAGGCAUGAUGAUGUGACACUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003554657.3 |
|
3.0 | PREDICTED: Glycine max auxin-responsive protein IAA16-like (LOC100803986), mRNA | auxin-responsive protein IAA16-like(LOC100803986) | coding protein | psRNATarget |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |