Search result

BaseInfo

ncRNA ID gma-miR1511
Species Glycine max
Class miRNA
Genome position chr18:21161236-21161334 [+]
Reference genome v1.0
Source miRBase
Length 20
Mature sequence(if miRNA) 70 - AACCAGGCUCUGAUACCAUG - 89
Stem-loop(if miRNA) ------   G            GU    C  C    A   GU    -U   CA
      UCA CCGUGGUAUCAG  CCUG UU AUCA GUG  CUUG  GUU  A
      ||| ||||||||||||  |||| || |||| |||  ||||  |||  A
      AGU GGUACCAUAGUC  GGAC AA UGGU CAC  GAAC  CGA  U
AAUAUA   -            UC    C  U    A   --    UC   CC
Stem-loop sequence UCAGCCGUGGUAUCAGGUCCUGCUUCAUCAAGUGGUCUUGUGUUCAAAUCCAGCCUCAAGCACAUGGUUAACCAGGCUCUGAUACCAUGGUGAAUAUAA

Reference

1 PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots";
Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O;
BMC Genomics. 9:160(2008).
2 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
3 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
4 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
5 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).