ncRNA ID | gma-miR4390 |
Species | Glycine max |
Class | miRNA |
Genome position | chr17:15539459-15539524 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 42 - UCGUACUCGUCGGGUAUCGGGUAU - 65 |
Stem-loop(if miRNA) |
C                    U    UU AUU  GUACCCGAUACUCGAUGGGU UGAG  U   G  |||||||||||||||||||| ||||  |  UAUGGGCUAUGGGCUGCUCA GCUC  A   U C                    U    CU CUC |
Stem-loop sequence | CGUACCCGAUACUCGAUGGGUUUGAGUUUAUUGUCUCAUCCUCGUACUCGUCGGGUAUCGGGUAUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_006598258.1 |
|
2.5 | PREDICTED: Glycine max polygalacturonase inhibitor 2-like (LOC102660019), mRNA | polygalacturonase inhibitor 2-like(LOC102660019) | coding protein | psRNATarget |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |