ncRNA ID | gma-miR1509a |
Species | Glycine max |
Class | miRNA |
Genome position | chr17:10099759-10099869 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 11 - UUAAUCAAGGAAAUCACGGUCG - 32 |
Stem-loop(if miRNA) |
CU    -CU  -             U        C --U U -U      -AAGAA  U   GCAU   UC UUAAUCAAGGAAA CACGGUCG G   G G  GCCGGA      AG G   ||||   || ||||||||||||| |||||||| |   | |  ||||||      ||   CGUG   AG AAUUGGUUCCUUU GUGCCAGC C   C C  UGGCCU      UC G --    UAU  C             -        U UUU U UU      CUAGUG  C |
Stem-loop sequence | CUGCAUCUUCUUAAUCAAGGAAAUCACGGUCGCGUGUGUGCCGGAAAGAAAGUGGCCUGUGAUCUCCGGUUUCUCUUUCUCGACCGUGUUUCCUUGGUUAACGAUAUGUGC |
1 | PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008). |
2 | PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"; Wang Y, Li P, Cao X, Wang X, Zhang A, Li X; Biochem Biophys Res Commun. 378:799-803(2009). |
3 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
4 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |