ncRNA ID | gma-miR171l |
Species | Glycine max |
Class | miRNA |
Genome position | chr17:9101701-9101798 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 71 - CGAUGUUGGUGAGGUUCAAUC - 91 |
Stem-loop(if miRNA) |
  G    C          A         C  A  -  -GA     A   A GA AAAG GAUGUUGGUG GGUUCAAUC GA GA CG   UUUAC UGU G || |||| |||||||||| ||||||||| || || ||   ||||| ||| CU UUUC CUAUAACCGC CCGAGUUAG CU CU GC   AAAUG ACG A   A    A          G         A  -  A  AUA     -   A |
Stem-loop sequence | GAGAAAGCGAUGUUGGUGAGGUUCAAUCCGAAGACGGAUUUACAUGUAGAAGCAGUAAAAUACGAUCUCAGAUUGAGCCGCGCCAAUAUCACUUUAUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003535598.3 |
|
2.5 | PREDICTED: Glycine max non-specific lipid-transfer protein-like protein At2g13820 (LOC100778264), mRNA | non-specific lipid-transfer protein-like protein At2g13820(LOC100778264) | coding protein | psRNATarget | |||||||||
XM_003545934.3 |
|
2.5 | PREDICTED: Glycine max L-type lectin-domain containing receptor kinase VII.1-like (LOC100794861), mRNA | L-type lectin-domain containing receptor kinase VII.1-like(LOC100794861) | coding protein | psRNATarget | |||||||||
XM_003542996.3 |
|
2.5 | PREDICTED: Glycine max L-type lectin-domain containing receptor kinase VII.1-like (LOC100804391), mRNA | L-type lectin-domain containing receptor kinase VII.1-like(LOC100804391) | coding protein | psRNATarget |
1 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |