ncRNA ID | gma-miR1514b-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr17:1497668-1497776 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 81 - AUGCCUAUUUUAAAAUGAAAA - 101 |
Stem-loop(if miRNA) |
CUUUGCUA          U       A       -  UCU  UUGUUCCUCUUU         UUUUCAUUUU AAAAUAG CAUUGGG CU   UC            U         |||||||||| ||||||| ||||||| ||   ||            U         AAAAGUAAAA UUUUAUC GUAAUCC GG   AG            U AUAGUAAC          -       C       U  UUU  CCUUAACCUUCC |
Stem-loop sequence | CUUUGCUAUUUUCAUUUUUAAAAUAGACAUUGGGCUUCUUCUUGUUCCUCUUUUUUCCUUCCAAUUCCGAUUUGGUCCUAAUGCCUAUUUUAAAAUGAAAACAAUGAUA |
1 | PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |