Search result

BaseInfo

ncRNA ID	gma-miR4994-3p
Species	Glycine max
Class	miRNA
Genome position	chr16:35590577-35590667 [+]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	63 - UGAUAUCCUUGAGCUAAUACA - 83
Stem-loop(if miRNA)	----------G              C             GU   A  G              GUUAGCUCAAGGAU UCACAUGAUCCAG  GGA UU AUC            |||||||||||||| |||||||||||||  ||| || ||A            UAAUCGAGUUCCUA AGUGUACUAGGUU  CCU AG UGG GUACUAUCACA              U             --   A  G
Stem-loop sequence	GGUUAGCUCAAGGAUCUCACAUGAUCCAGGUGGAAUUGAUCAGGUGGAAUCCUUGGAUCAUGUGAUAUCCUUGAGCUAAUACACUAUCAUG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_014775557.1	ncRNA:21   ACAUAAUCGAGUUCCUAUAGU   1   |*||||=|||||||||*|||| targets:682   UAUAUUGGCUCAAGGAAAUCA   702 Target Full Sequence	2.5	PREDICTED: Glycine max protein diaphanous homolog 1-like (LOC100791478), transcript variant X3, mRNA	protein diaphanous homolog 1-like(LOC100791478)	coding protein	psRNATarget
XM_006579768.2	ncRNA:21   ACAUAAUCGAGUUCCUAUAGU   1   |*||||=|||||||||*|||| targets:927   UAUAUUGGCUCAAGGAAAUCA   947 Target Full Sequence	2.5	PREDICTED: Glycine max protein diaphanous homolog 1-like (LOC100791478), transcript variant X1, mRNA	protein diaphanous homolog 1-like(LOC100791478)	coding protein	psRNATarget
XM_014775556.1	ncRNA:21   ACAUAAUCGAGUUCCUAUAGU   1   |*||||=|||||||||*|||| targets:1061   UAUAUUGGCUCAAGGAAAUCA   1081 Target Full Sequence	2.5	PREDICTED: Glycine max protein diaphanous homolog 1-like (LOC100791478), transcript variant X2, mRNA	protein diaphanous homolog 1-like(LOC100791478)	coding protein	psRNATarget

Reference

1	PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011).
2	PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014).