Search result

BaseInfo

ncRNA ID	gma-miR1508a
Species	Glycine max
Class	miRNA
Genome position	chr16:32903737-32903831 [+]
Reference genome	v1.0
Source	miRBase
Length	23
Mature sequence(if miRNA)	63 - UCUAGAAAGGGAAAUAGCAGUUG - 85
Stem-loop(if miRNA)	AAUU    UC           -   A      A   -   UUACA         GCUA  CAACUGCUAUU CCC UUUCUA ACC UUG     CGAGC     ||||  ||||||||||| ||| |||||| ||| |||     ||||A     UGGU  GUUGACGAUAA GGG AAAGAU UGG AAC     GUUCU UUCG    GA           A   -      C   U   ---UA
Stem-loop sequence	AAUUGCUAUCCAACUGCUAUUCCCAUUUCUAAACCUUGUUACACGAGCAUCUUGAUCAAUGGUCUAGAAAGGGAAAUAGCAGUUGAGUGGUGCUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006599409.2	ncRNA:23   GUUGACGAUAAAGGGAAAGAUCU   1   |*|||||*||||||||||||||| targets:372   CUACUGCCAUUUCCCUUUCUAGA   394 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12775, mitochondrial-like (LOC100813712), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At1g12775, mitochondrial-like(LOC100813712)	coding protein	psRNATarget
XM_006587773.2	ncRNA:23   GUUGACGAUAAAGGGAAAGAUCU   1   |*|||||*|||||||||||||*| targets:404   CCACUGCCAUUUCCCUUUCUAAA   426 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100778420), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100778420)	coding protein	psRNATarget
XM_006587774.2	ncRNA:23   GUUGACGAUAAAGGGAAAGAUCU   1   |*|||||*|||||||||||||*| targets:404   CCACUGCCAUUUCCCUUUCUAAA   426 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100778420), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100778420)	coding protein	psRNATarget
XM_006599424.2	ncRNA:23   GUUGACGAUAAAGGGAAAGAUCU   1   |*|||||*|||||||||||||*| targets:252   CCACUGCCAUUUCCCUUUCUAAA   274 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC100818504), transcript variant X6, mRNA	pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like(LOC100818504)	coding protein	psRNATarget
XM_006599423.2	ncRNA:23   GUUGACGAUAAAGGGAAAGAUCU   1   |*|||||*|||||||||||||*| targets:252   CCACUGCCAUUUCCCUUUCUAAA   274 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC100818504), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like(LOC100818504)	coding protein	psRNATarget
XM_014769273.1	ncRNA:23   GUUGACGAUAAAGGGAAAGAUCU   1   =*|||||*|||||||||||||*| targets:459   UUACUGCCAUUUCCCUUUCUAAA   481 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106796589), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106796589)	coding protein	psRNATarget

Reference

1	PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008).
2	PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"; Wang Y, Li P, Cao X, Wang X, Zhang A, Li X; Biochem Biophys Res Commun. 378:799-803(2009).
3	PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011).
4	PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011).