Search result

BaseInfo

ncRNA ID gma-miR1510a-5p
Species Glycine max
Class miRNA
Genome position chr16:31518908-31519000 [+]
Reference genome v1.0
Source miRBase
Length 24
Mature sequence(if miRNA) 13 - AGGGAUAGGUAAAACAAUGACUGC - 36
Stem-loop(if miRNA) -U       CU  A                UG    -     -   G
  UAUGGAA  GG GGGAUAGGUAAAACAA  ACUG CUGUA UAA U
  |||||||  || ||||||||||||||||  |||| ||||| |||
  GUACCUU  CC CCUUAUCCAUUUUGUU  UGAU GAUAU GUU A
AU       AC  A                GU    U     U   A
Stem-loop sequence UUAUGGAACUGGAGGGAUAGGUAAAACAAUGACUGCUGUAUAAGUAAUUGUUAUAGUUAGUUGUUGUUUUACCUAUUCCACCCAUUCCAUGUA

Reference

1 PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots";
Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O;
BMC Genomics. 9:160(2008).
2 PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules";
Wang Y, Li P, Cao X, Wang X, Zhang A, Li X;
Biochem Biophys Res Commun. 378:799-803(2009).
3 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
4 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
5 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
6 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).