Search result

BaseInfo

ncRNA ID gma-miR166a-5p
Species Glycine max
Class miRNA
Genome position chr16:1912570-1912715 [-]
Reference genome v1.0
Source miRBase
Length 21
Mature sequence(if miRNA) 104 - GGAAUGUUGUCUGGCUCGAGG - 124
Stem-loop(if miRNA) -AC      UU   CUU   A        UU      CU   G   C  -UCUUCA        --UU      A
   GGAAGC  UGU   UUG GGGGAAUG  GUCUGG  CGA GAC CU       UCUUGAUC    GUGUAG C
   ||||||  |||   ||| ||||||||  ||||||  ||| ||| ||       ||||||||    ||||||
   CCUUCG  AUA   AAC CCCCUUAC  CGGACC  GCU UUG GA       GGAACUGG    CGUAUC U
AAA      -U   -UU   C        UU      AG   G   U  UACAUAA        UGUU      A
Stem-loop sequence ACGGAAGCUUUGUCUUUUGAGGGGAAUGUUGUCUGGCUCGAGGACCCUUCUUCAUCUUGAUCUUGUGUAGACUACUAUGCUUGUGGUCAAGGAAUACAUAGUGUUGUCGGACCAGGCUUCAUUCCCCCCAAUUAUAUGCUUCCAAA

Reference

1 PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots";
Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O;
BMC Genomics. 9:160(2008).
2 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).