ncRNA ID | gma-miR3522 |
Species | Glycine max |
Class | miRNA |
Genome position | chr15:4318787-4318873 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 19 |
Mature sequence(if miRNA) | 13 - AGACCAAAUGAGCAGCUGA - 31 |
Stem-loop(if miRNA) |
   AU  U       C  A            -CCA  UGAU   G AGG  CG CCUGAGA CA AUGAGCAGCUGA    CA    GCA C |||  || ||||||| || ||||||||||||    ||    ||| UCC  GC GGACUCU GU UACUCGUCGACU    GU    UGU U    -C  U       U  C            UAUC  ---U   A |
Stem-loop sequence | AGGAUCGUCCUGAGACCAAAUGAGCAGCUGACCACAUGAUGCAGCUAUGUUUGCUAUUCAGCUGCUCAUCUGUUCUCAGGUCGCCCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_014778114.1 |
|
2.0 | PREDICTED: Glycine max polyphenol oxidase A1, chloroplastic-like (LOC106799477), mRNA | polyphenol oxidase A1, chloroplastic-like(LOC106799477) | coding protein | psRNATarget | |||||||||
XM_006583745.2 |
|
2.0 | PREDICTED: Glycine max polyphenol oxidase II, chloroplastic-like (LOC100803874), mRNA | polyphenol oxidase II, chloroplastic-like(LOC100803874) | coding protein | psRNATarget | |||||||||
XM_006583742.2 |
|
2.0 | PREDICTED: Glycine max polyphenol oxidase I, chloroplastic-like (LOC100801754), mRNA | polyphenol oxidase I, chloroplastic-like(LOC100801754) | coding protein | psRNATarget |
1 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
2 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |
3 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |