Search result

BaseInfo

ncRNA ID	gma-miR394d
Species	Glycine max
Class	miRNA
Genome position	chr15:3767178-3767260 [+]
Reference genome	v1.0
Source	miRBase
Length	20
Mature sequence(if miRNA)	11 - UUGGCAUUCUGUCCACCUCC - 30
Stem-loop(if miRNA)	-      - -AU        U   U         -U    GA  CAUAGA C   UUUGGCAU CUG CCACCUCCA  UGGU  U  |||||| |   |||||||| ||| |||||||||  ||||  G  GUGUCU G   AAACCGUA GAC GGUGGAGGU  ACCG  A U      C GGC        U   C         UU    GU
Stem-loop sequence	CAUAGACAUUUUGGCAUUCUGUCCACCUCCAUUGGUGAUGAUGGCCAUUUGGAGGUGGCCAGUAUGCCAAACGGGCUCUGUGU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006601824.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1172   GGAGGUUGACAGAAUGCCAA   1191 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100810179), transcript variant X2, mRNA	F-box only protein 6-like(LOC100810179)	coding protein	psRNATarget
XM_014764280.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1224   GGAGGUUGACAGAAUGCCAA   1243 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100795488), transcript variant X2, mRNA	F-box only protein 6-like(LOC100795488)	coding protein	psRNATarget
XM_006591384.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1239   GGAGGUUGACAGAAUGCCAA   1258 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100795488), transcript variant X1, mRNA	F-box only protein 6-like(LOC100795488)	coding protein	psRNATarget
XM_003551124.3	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1402   GGAGGUUGACAGAAUGCCAA   1421 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100810179), transcript variant X1, mRNA	F-box only protein 6-like(LOC100810179)	coding protein	psRNATarget
XM_014771056.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1516   GGAGGUUGACAGAAUGCCAA   1535 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100810179), transcript variant X3, mRNA	F-box only protein 6-like(LOC100810179)	coding protein	psRNATarget
XM_003531151.3	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1187   GGAGGUUGACAGAAUGCCAA   1206 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100775721), transcript variant X2, mRNA	F-box only protein 6-like(LOC100775721)	coding protein	psRNATarget
XM_014778856.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1087   GGAGGUUGACAGAAUGCCAA   1106 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100775721), transcript variant X3, mRNA	F-box only protein 6-like(LOC100775721)	coding protein	psRNATarget
NM_001289351.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1192   GGAGGUUGACAGAAUGCCAA   1211 Target Full Sequence	1.0	Glycine max F-box only protein 6-like (LOC100800464), mRNA	F-box only protein 6-like(LOC100800464)	coding protein	psRNATarget
BT093518.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1194   GGAGGUUGACAGAAUGCCAA   1213 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-24M21 unknown mRNA	NA	coding protein	psRNATarget
XM_014778855.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1187   GGAGGUUGACAGAAUGCCAA   1206 Target Full Sequence	1.0	PREDICTED: Glycine max F-box only protein 6-like (LOC100775721), transcript variant X1, mRNA	F-box only protein 6-like(LOC100775721)	coding protein	psRNATarget
XM_006604639.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   *|||||*||||*|||||||| targets:572   UGAGGUUGACAAAAUGCCAA   591 Target Full Sequence	2.5	PREDICTED: Glycine max monothiol glutaredoxin-S6-like (LOC100803979), mRNA	monothiol glutaredoxin-S6-like(LOC100803979)	coding protein	psRNATarget
XM_006603175.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1116   CUUGUUGGACAGAAUGCCAA   1135 Target Full Sequence	3.0	PREDICTED: Glycine max disease resistance RPP13-like protein 4 (LOC102666933), mRNA	disease resistance RPP13-like protein 4(LOC102666933)	coding protein	psRNATarget
XM_006586501.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1143   CUUGUUGGACAGAAUGCCAA   1162 Target Full Sequence	3.0	PREDICTED: Glycine max uncharacterized LOC102664151 (LOC102664151), mRNA	uncharacterized LOC102664151(LOC102664151)	coding protein	psRNATarget
XM_006585994.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1182   CUUGUUGGACAGAAUGCCAA   1201 Target Full Sequence	3.0	PREDICTED: Glycine max uncharacterized LOC102661060 (LOC102661060), mRNA	uncharacterized LOC102661060(LOC102661060)	coding protein	psRNATarget
XM_006585996.2	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ***|*||||||||||||||| targets:1335   CUUGUUGGACAGAAUGCCAA   1354 Target Full Sequence	3.0	PREDICTED: Glycine max disease resistance RPP13-like protein 4 (LOC102662112), mRNA	disease resistance RPP13-like protein 4(LOC102662112)	coding protein	psRNATarget

Reference

1

PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011).