ncRNA ID | gma-miR394b-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr14:48984878-48984981 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 12 - AGGUGGGCAUACUGUCAACU - 31 |
Stem-loop(if miRNA) |
       GU   -      U C            -    - -U  -----U   U UAACAGA  UUA UUGGCA U UGUCCACCUCCA CUUC C  AC      CUC C |||||||  ||| |||||| | |||||||||||| |||| |  ||      ||| U GUUGUCU  AGU AACUGU A ACGGGUGGAGGU GAAG G  UG      GAG C        UG   C      C U            U    U CU  UACACC   U |
Stem-loop sequence | UAACAGAGUUUAUUGGCAUUCUGUCCACCUCCACUUCCUACUCUCUCUCUGAGCCACAUGUUCGUGAAGUUGGAGGUGGGCAUACUGUCAACUGAGUUCUGUUG |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
2 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |