ncRNA ID | gma-miR1520n |
Species | Glycine max |
Class | miRNA |
Genome position | chr14:48153009-48153104 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 71 - UCAAUCAGAACAUGACACGUGACA - 94 |
Stem-loop(if miRNA) |
          A               ---   UC   UC  UUAAAAA AUUGUCAUGU UUAUGUUUUGAUUGA   AUG  AAU  CA       U |||||||||| |||||||||||||||   |||  |||  ||       A UGACAGUGCA AGUACAAGACUAACU   UAC  UUA  GU       A           C               AAU   UU   UU  UAUGUAA |
Stem-loop sequence | AUUGUCAUGUAUUAUGUUUUGAUUGAAUGUCAAUUCCAUUAAAAAUAAAAUGUAUUGUUAUUUUCAUUAAUCAAUCAGAACAUGACACGUGACAGU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003518407.3 |
|
2.5 | PREDICTED: Glycine max UPF0481 protein At3g47200-like (LOC100803577), mRNA | UPF0481 protein At3g47200-like(LOC100803577) | coding protein | psRNATarget | |||||||||
XM_003547146.3 |
|
2.5 | PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g09900-like (LOC100802835), mRNA | pentatricopeptide repeat-containing protein At1g09900-like(LOC100802835) | coding protein | psRNATarget |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |