ncRNA ID | ath-miR172b-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr5:1188207-1188301 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 72 - GCAGCACCAUUAAGAUUCAC - 91 |
Stem-loop(if miRNA) |
--A GC      C           A    GAA  UGA    U          G  GCAGCA CAUUAAGAUUC CAUG   AU   UAAA ACCCUAA    |  |||||| ||||||||||| ||||   ||   |||| ||||||A    C  CGUCGU GUAGUUCUAAG GUAU   UA   GUUU UGGGAUU CAA UA      A           A    AUG  -UA    -       |
Stem-loop sequence | AGGCGCAGCACCAUUAAGAUUCACAUGGAAAUUGAUAAAUACCCUAAAUUAGGGUUUUGAUAUGUAUAUGAGAAUCUUGAUGAUGCUGCAUCAAC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BX820988.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH89ZF10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
U52851.2 |
|
2.5 | Arabidopsis thaliana arginine decarboxylase (ARGdc) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BT008636.1 |
|
2.5 | Arabidopsis thaliana clone RAFL09-94-E10 (R19735) putative arginine decarboxylase (At2g16500) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_127204.3 |
|
2.5 | Arabidopsis thaliana arginine decarboxylase 1 (ADC1), mRNA | arginine decarboxylase 1(ADC1) | coding protein | psRNATarget |
1 | PMID:12225663
"CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"; Park W, Li J, Song R, Messing J, Chen X; Curr Biol. 12:1484-1495(2002). |
2 | PMID:12226481
"Short RNAs can identify new candidate transposable element families in Arabidopsis"; Mette MF, van der Winden J, Matzke M, Matzke AJ; Plant Physiol. 130:6-9(2002). |
3 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
4 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
5 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
6 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
7 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |