Search result

BaseInfo

ncRNA ID ath-miR172b-5p
Species Arabidopsis thaliana
Class miRNA
Genome position chr5:1188207-1188301 [-]
Reference genome TAIR10
Source miRBase
Length 20
Mature sequence(if miRNA) 72 - GCAGCACCAUUAAGAUUCAC - 91
Stem-loop(if miRNA) --A GC      C           A    GAA  UGA    U      
   G  GCAGCA CAUUAAGAUUC CAUG   AU   UAAA ACCCUAA
   |  |||||| ||||||||||| ||||   ||   |||| ||||||A
   C  CGUCGU GUAGUUCUAAG GUAU   UA   GUUU UGGGAUU
CAA UA      A           A    AUG  -UA    -      
Stem-loop sequence AGGCGCAGCACCAUUAAGAUUCACAUGGAAAUUGAUAAAUACCCUAAAUUAGGGUUUUGAUAUGUAUAUGAGAAUCUUGAUGAUGCUGCAUCAAC

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
BX820988.1
ncRNA:20   CACUUAGAAUUACCACGACG   1
  |*|||||||*||||||||||
targets:1672   GAGAAUCUUUAUGGUGCUGC   1691

2.5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH89ZF10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) NA coding protein psRNATarget
U52851.2
ncRNA:20   CACUUAGAAUUACCACGACG   1
  |*|||||||*||||||||||
targets:1637   GAGAAUCUUUAUGGUGCUGC   1656

2.5 Arabidopsis thaliana arginine decarboxylase (ARGdc) mRNA, complete cds NA coding protein psRNATarget
BT008636.1
ncRNA:20   CACUUAGAAUUACCACGACG   1
  |*|||||||*||||||||||
targets:1690   GAGAAUCUUUAUGGUGCUGC   1709

2.5 Arabidopsis thaliana clone RAFL09-94-E10 (R19735) putative arginine decarboxylase (At2g16500) mRNA, complete cds NA coding protein psRNATarget
NM_127204.3
ncRNA:20   CACUUAGAAUUACCACGACG   1
  |*|||||||*||||||||||
targets:1781   GAGAAUCUUUAUGGUGCUGC   1800

2.5 Arabidopsis thaliana arginine decarboxylase 1 (ADC1), mRNA arginine decarboxylase 1(ADC1) coding protein psRNATarget

Reference

1 PMID:12225663
"CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana";
Park W, Li J, Song R, Messing J, Chen X;
Curr Biol. 12:1484-1495(2002).
2 PMID:12226481
"Short RNAs can identify new candidate transposable element families in Arabidopsis";
Mette MF, van der Winden J, Matzke M, Matzke AJ;
Plant Physiol. 130:6-9(2002).
3 PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets";
Wang XJ, Reyes JL, Chua NH, Gaasterland T;
Genome Biol. 5:R65(2004).
4 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
5 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
6 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
7 PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis";
Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW;
J Exp Bot. 61:165-177(2010).