ncRNA ID | gma-miR390b-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr14:47097976-47098078 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 68 - UACUUGGCGCUAUCUAUCUUGA - 89 |
Stem-loop(if miRNA) |
    U    A          G       A   U A   --UG UG     AU AGAA CUGU AAGCUCAGGA GGAUAGC CCG G UAC    A  AUUAU  G |||| |||| |||||||||| ||||||| ||| | |||    |  ||||| UCUU GGUA UUCGAGUUCU UCUAUCG GGU C AUG    U  UGAUA  U     C    C          A       C   U -   CAUA GU     CU |
Stem-loop sequence | AGAAUCUGUAAAGCUCAGGAGGGAUAGCACCGUGAUACUGAUGAUUAUAUGUUCAUAGUUGUAUACGUACUUGGCGCUAUCUAUCUUGAGCUUCAUGGCUUCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003528355.3 |
|
2.5 | PREDICTED: Glycine max oligopeptide transporter 4-like (LOC100819886), mRNA | oligopeptide transporter 4-like(LOC100819886) | coding protein | psRNATarget |
1 | PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008). |
2 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
3 | PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011). |