ncRNA ID | gma-miR4401a |
Species | Glycine max |
Class | miRNA |
Genome position | chr14:24664928-24665043 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 85 - ACAACGUCUUUGAAAGUAGGCAUU - 108 |
Stem-loop(if miRNA) |
      U                    A                      U   A U CGUCUU GAAUGCCUACUUUCAAAGAC UUGUUGAGGUAAGCACCGUCUU GAA G A |||||| |||||||||||||||||||| |||||||||||||||||||||| ||| | GCAGAA CUUACGGAUGAAAGUUUCUG AACAACUCCAUUCGUGGUAGAA CUU C C       U                    C                      U   A G |
Stem-loop sequence | CGUCUUUGAAUGCCUACUUUCAAAGACAUUGUUGAGGUAAGCACCGUCUUUGAAAGUACGCAUUCUAAGAUGGUGCUUACCUCAACAACGUCUUUGAAAGUAGGCAUUCUAAGACG |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |