Search result

BaseInfo

ncRNA ID gma-miR4376-5p
Species Glycine max
Class miRNA
Genome position chr13:40845925-40846034 [+]
Reference genome v1.0
Source miRBase
Length 22
Mature sequence(if miRNA) 10 - UACGCAGGAGAGAUGACGCUGU - 31
Stem-loop(if miRNA)            C        G    C    U ---      A CCAU    G   C
AAGGUUUGCUA GCAGGAGA AUGA GCUG C   CCUUGC C    CCUA CUU C
||||||||||| |||||||| |||| |||| |   |||||| |    |||| ||| C
UUCCAAAUGAU CGUCCUCU UACU CGAC G   GGAACG G    GGAU GAG U
           A        A    A    C ACC      A -AAU    -   U
Stem-loop sequence AAGGUUUGCUACGCAGGAGAGAUGACGCUGUCCCUUGCACCCAUCCUAGCUUCCCUUGAGUAGGUAAGAGCAAGGCCAGCCAGCAUCAUAUCUCCUGCAUAGUAAACCUU

Reference

1 PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max";
Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G;
BMC Bioinformatics. 11 Suppl 1:S14(2010).
2 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
3 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).