ncRNA ID | gma-miR171o-5p |
Species | Glycine max |
Class | miRNA |
Genome position | chr13:30650791-30650892 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - AGAUAUUGGUACGGUUCAAUC - 31 |
Stem-loop(if miRNA) |
U   --G  U  A                       A  C  U      UG  AAG   GC UG GAUAUUGGUACGGUUCAAUCAGA GA AG GCUUUA  A  |||   || || ||||||||||||||||||||||| || || ||||||  UUC   CG AC CUAUAACCGUGCCGAGUUAGUUU UU UC CGAAAU  U U   AAA  U  A                       A  C  U      CU |
Stem-loop sequence | UAAGGGCUUGAGAUAUUGGUACGGUUCAAUCAGAAGACAGUGCUUUAUGAUUCUAAAGCUCUCUUAUUUGAUUGAGCCGUGCCAAUAUCACAUGCAAACUUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
JB170970.1 |
|
2.5 | Sequence 8634 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
HI410509.1 |
|
2.5 | Sequence 8634 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
LQ242639.1 |
|
2.5 | Sequence 8634 from Patent EP2985353 | NA | coding protein | psRNATarget |
1 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |
2 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |